|
|
remap |
The home page of REBASE is: http://rebase.neb.com/
This program uses REBASE data to find the recognition sites and/or cut sites of restriction enzymes in a nucleic acid sequence.
This program displays the cut sites on both strands by default. It will optionally also display the translation of the sequence.
There are many options to change the style of display to aid in making clear presentations.
One potentially very useful option is '-flatreformat' that displays not only the cut sites which many other restriction cut-site programs will show, but also shows the recognition site.
By default, only one of any group of isoschizomers (enzymes that have the same recognition site and cut positions) is reported (this behaviour can be turned off by setting the qualifier '-limit' to be false.) The reported enzyme from any one group of isoschizomers (the prototype) is specified in the REBASE database and the information is held in the data file 'embossre.equ'. You may edit this file to set your own preferred prototype,if you wish.
As well as the display of where enzymes cut in the sequence, remap displays:
This example uses only a small region of the input sequence to save space. This is run with a small test version of the restriction enzyme database and so you will probably see more enzymes when you run this.
% remap -notran -sbeg 1 -send 60 Display a sequence with restriction cut sites, translation etc.. Input sequence(s): tembl:eclac Comma separated enzyme list [all]: taqi,bsu6i,acii,bsski Minimum recognition site length [4]: Output file [eclac.remap]: |
Go to the input files for this example
Go to the output files for this example
Example 2
This is an example where all enzymes in the REBASE database are used, (but only the prototypes of the isoschizomers are reported by default). This is run with a small test version of the restriction enzyme database and so you will probably see more enzymes when you run this.
% remap -notran -sbeg 1 -send 60 Display a sequence with restriction cut sites, translation etc.. Input sequence(s): tembl:eclac Comma separated enzyme list [all]: Minimum recognition site length [4]: Output file [eclac.remap]: |
Go to the output files for this example
Example 3
This is an example where all enzymes in the REBASE database are used but the -limit qualifier is not set so that all of the enzymes are displayed and not just only the prototypes of the isoschizomers. This is run with a small test version of the restriction enzyme database and so you will probably see more enzymes when you run this.
% remap -notran -sbeg 1 -send 60 -nolimit Display a sequence with restriction cut sites, translation etc.. Input sequence(s): tembl:eclac Comma separated enzyme list [all]: Minimum recognition site length [4]: Output file [eclac.remap]: |
Go to the output files for this example
Example 4
This shows the 'flat' format: This is run with a small test version of the restriction enzyme database and so you will probably see more enzymes when you run this.
% remap -notran -sbeg 1 -send 60 -flat Display a sequence with restriction cut sites, translation etc.. Input sequence(s): tembl:eclac Comma separated enzyme list [all]: Minimum recognition site length [4]: Output file [eclac.remap]: |
Go to the output files for this example
Standard (Mandatory) qualifiers:
[-sequence] seqall Sequence database USA
-enzymes string The name 'all' reads in all enzyme names
from the REBASE database. You can specify
enzymes by giving their names with commas
between then, such as:
'HincII,hinfI,ppiI,hindiii'.
The case of the names is not important. You
can specify a file of enzyme names to read
in by giving the name of the file holding
the enzyme names with a '@' character in
front of it, for example, '@enz.list'.
Blank lines and lines starting with a hash
character or '!' are ignored and all other
lines are concatenated together with a comma
character ',' and then treated as the list
of enzymes to search for.
An example of a file of enzyme names is:
! my enzymes
HincII, ppiII
! other enzymes
hindiii
HinfI
PpiI
-sitelen integer This sets the minimum length of the
restriction enzyme recognition site. Any
enzymes with sites shorter than this will be
ignored.
[-outfile] outfile Output file name
Additional (Optional) qualifiers:
-mincuts integer This sets the minimum number of cuts for any
restriction enzyme that will be considered.
Any enzymes that cut fewer times than this
will be ignored.
-maxcuts integer This sets the maximum number of cuts for any
restriction enzyme that will be considered.
Any enzymes that cut more times than this
will be ignored.
-single boolean If this is set then this forces the values
of the mincuts and maxcuts qualifiers to
both be 1. Any other value you may have set
them to will be ignored.
-[no]blunt boolean This allows those enzymes which cut at the
same position on the forward and reverse
strands to be considered.
-[no]sticky boolean This allows those enzymes which cut at
different positions on the forward and
reverse strands, leaving an overhang, to be
considered.
-[no]ambiguity boolean This allows those enzymes which have one or
more 'N' ambiguity codes in their pattern to
be considered
-plasmid boolean If this is set then this allows searches for
restriction enzyme recognition site and cut
postions that span the end of the sequence
to be considered.
-[no]commercial boolean If this is set, then only those enzymes with
a commercial supplier will be searched for.
This qualifier is ignored if you have
specified an explicit list of enzymes to
search for, rather than searching through
'all' the enzymes in the REBASE database. It
is assumed that, if you are asking for an
explicit enzyme, then you probably know
where to get it from and so all enzymes
names that you have asked to be searched
for, and which cut, will be reported whether
or not they have a commercial supplier.
-table menu Genetic code to use
-frame menu This allows you to specify the frames that
are translated. If you are not displaying
cut sites on the reverse sense, then the
reverse sense translations will not be
displayed even if you have requested frames
4, 5 or 6. By default, all six frames will
be displayed.
-[no]cutlist boolean This produces lists in the output of the
enzymes that cut, those that cut but are
excluded because that cut fewer times than
mincut or more times than maxcut and those
enzymes that do not cut.
-flatreformat boolean This changes the output format to one where
the recognition site is indicated by a row
of '===' characters and the cut site is
pointed to by a '>' character in the forward
sense, or a '<' in the reverse sense
strand.
-[no]limit boolean This limits the reporting of enzymes to just
one enzyme from each group of
isoschizomers. The enzyme chosen to
represent an isoschizomer group is the
prototype indicated in the data file
'embossre.equ', which is created by the
program 'rebaseextract'. If you prefer
different prototypes to be used, make a copy
of embossre.equ in your home directory and
edit it. If this value is set to be false
then all of the input enzymes will be
reported. You might like to set this to
false if you are supplying an explicit set
of enzymes rather than searching 'all' of
them.
Advanced (Unprompted) qualifiers:
-[no]translation boolean This displays the 6-frame translations of
the sequence in the output.
-[no]reverse boolean This displays the cut sites and translation
of the reverse sense.
-orfminsize integer This sets the minimum size of Open Reading
Frames (ORFs) to display in the
translations. All other translation regions
are masked by changing the amino acids to
'-' characters.
-uppercase range Regions to put in uppercase.
If this is left blank, then the sequence
case is left alone.
A set of regions is specified by a set of
pairs of positions.
The positions are integers.
They are separated by any non-digit,
non-alpha character.
Examples of region specifications are:
24-45, 56-78
1:45, 67=99;765..888
1,5,8,10,23,45,57,99
-highlight range Regions to colour if formatting for HTML.
If this is left blank, then the sequence is
left alone.
A set of regions is specified by a set of
pairs of positions.
The positions are integers.
They are followed by any valid HTML font
colour.
Examples of region specifications are:
24-45 blue 56-78 orange
1-100 green 120-156 red
A file of ranges to colour (one range per
line) can be specifed as '@filename'.
-threeletter boolean Display protein sequences in three-letter
code
-number boolean Number the sequences
-width integer Width of sequence to display
-length integer Line length of page (0 for indefinite)
-margin integer Margin around sequence for numbering
-[no]name boolean Set this to be false if you do not wish to
display the ID name of the sequence
-[no]description boolean Set this to be false if you do not wish to
display the description of the sequence
-offset integer Offset to start numbering the sequence from
-html boolean Use HTML formatting
Associated qualifiers:
"-sequence" associated qualifiers
-sbegin1 integer Start of each sequence to be used
-send1 integer End of each sequence to be used
-sreverse1 boolean Reverse (if DNA)
-sask1 boolean Ask for begin/end/reverse
-snucleotide1 boolean Sequence is nucleotide
-sprotein1 boolean Sequence is protein
-slower1 boolean Make lower case
-supper1 boolean Make upper case
-sformat1 string Input sequence format
-sdbname1 string Database name
-sid1 string Entryname
-ufo1 string UFO features
-fformat1 string Features format
-fopenfile1 string Features file name
"-outfile" associated qualifiers
-odirectory2 string Output directory
General qualifiers:
-auto boolean Turn off prompts
-stdout boolean Write standard output
-filter boolean Read standard input, write standard output
-options boolean Prompt for standard and additional values
-debug boolean Write debug output to program.dbg
-verbose boolean Report some/full command line options
-help boolean Report command line options. More
information on associated and general
qualifiers can be found with -help -verbose
-warning boolean Report warnings
-error boolean Report errors
-fatal boolean Report fatal errors
-die boolean Report deaths
|
| Standard (Mandatory) qualifiers | Allowed values | Default | |||||||||||||||||||||||||||||||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
| [-sequence] (Parameter 1) |
Sequence database USA | Readable sequence(s) | Required | ||||||||||||||||||||||||||||||||||||
| -enzymes | The name 'all' reads in all enzyme names from the REBASE database. You can specify enzymes by giving their names with commas between then, such as: 'HincII,hinfI,ppiI,hindiii'. The case of the names is not important. You can specify a file of enzyme names to read in by giving the name of the file holding the enzyme names with a '@' character in front of it, for example, '@enz.list'. Blank lines and lines starting with a hash character or '!' are ignored and all other lines are concatenated together with a comma character ',' and then treated as the list of enzymes to search for. An example of a file of enzyme names is: ! my enzymes HincII, ppiII ! other enzymes hindiii HinfI PpiI | Any string is accepted | all | ||||||||||||||||||||||||||||||||||||
| -sitelen | This sets the minimum length of the restriction enzyme recognition site. Any enzymes with sites shorter than this will be ignored. | Integer from 2 to 20 | 4 | ||||||||||||||||||||||||||||||||||||
| [-outfile] (Parameter 2) |
Output file name | Output file | <sequence>.remap | ||||||||||||||||||||||||||||||||||||
| Additional (Optional) qualifiers | Allowed values | Default | |||||||||||||||||||||||||||||||||||||
| -mincuts | This sets the minimum number of cuts for any restriction enzyme that will be considered. Any enzymes that cut fewer times than this will be ignored. | Integer from 1 to 1000 | 1 | ||||||||||||||||||||||||||||||||||||
| -maxcuts | This sets the maximum number of cuts for any restriction enzyme that will be considered. Any enzymes that cut more times than this will be ignored. | Integer up to 2000000000 | 2000000000 | ||||||||||||||||||||||||||||||||||||
| -single | If this is set then this forces the values of the mincuts and maxcuts qualifiers to both be 1. Any other value you may have set them to will be ignored. | Boolean value Yes/No | No | ||||||||||||||||||||||||||||||||||||
| -[no]blunt | This allows those enzymes which cut at the same position on the forward and reverse strands to be considered. | Boolean value Yes/No | Yes | ||||||||||||||||||||||||||||||||||||
| -[no]sticky | This allows those enzymes which cut at different positions on the forward and reverse strands, leaving an overhang, to be considered. | Boolean value Yes/No | Yes | ||||||||||||||||||||||||||||||||||||
| -[no]ambiguity | This allows those enzymes which have one or more 'N' ambiguity codes in their pattern to be considered | Boolean value Yes/No | Yes | ||||||||||||||||||||||||||||||||||||
| -plasmid | If this is set then this allows searches for restriction enzyme recognition site and cut postions that span the end of the sequence to be considered. | Boolean value Yes/No | No | ||||||||||||||||||||||||||||||||||||
| -[no]commercial | If this is set, then only those enzymes with a commercial supplier will be searched for. This qualifier is ignored if you have specified an explicit list of enzymes to search for, rather than searching through 'all' the enzymes in the REBASE database. It is assumed that, if you are asking for an explicit enzyme, then you probably know where to get it from and so all enzymes names that you have asked to be searched for, and which cut, will be reported whether or not they have a commercial supplier. | Boolean value Yes/No | Yes | ||||||||||||||||||||||||||||||||||||
| -table | Genetic code to use |
|
0 | ||||||||||||||||||||||||||||||||||||
| -frame | This allows you to specify the frames that are translated. If you are not displaying cut sites on the reverse sense, then the reverse sense translations will not be displayed even if you have requested frames 4, 5 or 6. By default, all six frames will be displayed. |
|
6 | ||||||||||||||||||||||||||||||||||||
| -[no]cutlist | This produces lists in the output of the enzymes that cut, those that cut but are excluded because that cut fewer times than mincut or more times than maxcut and those enzymes that do not cut. | Boolean value Yes/No | Yes | ||||||||||||||||||||||||||||||||||||
| -flatreformat | This changes the output format to one where the recognition site is indicated by a row of '===' characters and the cut site is pointed to by a '>' character in the forward sense, or a '<' in the reverse sense strand. | Boolean value Yes/No | No | ||||||||||||||||||||||||||||||||||||
| -[no]limit | This limits the reporting of enzymes to just one enzyme from each group of isoschizomers. The enzyme chosen to represent an isoschizomer group is the prototype indicated in the data file 'embossre.equ', which is created by the program 'rebaseextract'. If you prefer different prototypes to be used, make a copy of embossre.equ in your home directory and edit it. If this value is set to be false then all of the input enzymes will be reported. You might like to set this to false if you are supplying an explicit set of enzymes rather than searching 'all' of them. | Boolean value Yes/No | Yes | ||||||||||||||||||||||||||||||||||||
| Advanced (Unprompted) qualifiers | Allowed values | Default | |||||||||||||||||||||||||||||||||||||
| -[no]translation | This displays the 6-frame translations of the sequence in the output. | Boolean value Yes/No | Yes | ||||||||||||||||||||||||||||||||||||
| -[no]reverse | This displays the cut sites and translation of the reverse sense. | Boolean value Yes/No | Yes | ||||||||||||||||||||||||||||||||||||
| -orfminsize | This sets the minimum size of Open Reading Frames (ORFs) to display in the translations. All other translation regions are masked by changing the amino acids to '-' characters. | Integer 0 or more | If this value is left as 0 then all of the translation is shown. | ||||||||||||||||||||||||||||||||||||
| -uppercase | Regions to put in uppercase. If this is left blank, then the sequence case is left alone. A set of regions is specified by a set of pairs of positions. The positions are integers. They are separated by any non-digit, non-alpha character. Examples of region specifications are: 24-45, 56-78 1:45, 67=99;765..888 1,5,8,10,23,45,57,99 | Sequence range | If this is left blank, then the sequence case is left alone. | ||||||||||||||||||||||||||||||||||||
| -highlight | Regions to colour if formatting for HTML. If this is left blank, then the sequence is left alone. A set of regions is specified by a set of pairs of positions. The positions are integers. They are followed by any valid HTML font colour. Examples of region specifications are: 24-45 blue 56-78 orange 1-100 green 120-156 red A file of ranges to colour (one range per line) can be specifed as '@filename'. | Sequence range | full sequence | ||||||||||||||||||||||||||||||||||||
| -threeletter | Display protein sequences in three-letter code | Boolean value Yes/No | No | ||||||||||||||||||||||||||||||||||||
| -number | Number the sequences | Boolean value Yes/No | No | ||||||||||||||||||||||||||||||||||||
| -width | Width of sequence to display | Integer 1 or more | 60 | ||||||||||||||||||||||||||||||||||||
| -length | Line length of page (0 for indefinite) | Integer 0 or more | 0 | ||||||||||||||||||||||||||||||||||||
| -margin | Margin around sequence for numbering | Integer 0 or more | 10 | ||||||||||||||||||||||||||||||||||||
| -[no]name | Set this to be false if you do not wish to display the ID name of the sequence | Boolean value Yes/No | Yes | ||||||||||||||||||||||||||||||||||||
| -[no]description | Set this to be false if you do not wish to display the description of the sequence | Boolean value Yes/No | Yes | ||||||||||||||||||||||||||||||||||||
| -offset | Offset to start numbering the sequence from | Any integer value | 1 | ||||||||||||||||||||||||||||||||||||
| -html | Use HTML formatting | Boolean value Yes/No | No | ||||||||||||||||||||||||||||||||||||
ID ECLAC standard; DNA; PRO; 7477 BP.
XX
AC J01636; J01637; K01483; K01793;
XX
SV J01636.1
XX
DT 30-NOV-1990 (Rel. 26, Created)
DT 04-MAR-2000 (Rel. 63, Last updated, Version 7)
XX
DE E.coli lactose operon with lacI, lacZ, lacY and lacA genes.
XX
KW acetyltransferase; beta-D-galactosidase; galactosidase; lac operon;
KW lac repressor protein; lacA gene; lacI gene; lactose permease; lacY gene;
KW lacZ gene; mutagenesis; palindrome; promoter region;
KW thiogalactoside acetyltransferase.
XX
OS Escherichia coli
OC Bacteria; Proteobacteria; gamma subdivision; Enterobacteriaceae;
OC Escherichia.
XX
RN [1]
RP 1243-1266
RX MEDLINE; 74055539.
RA Gilbert W., Maxam A.;
RT "The nucleotide sequence of the lac operator";
RL Proc. Natl. Acad. Sci. U.S.A. 70:3581-3584(1973).
XX
RN [2]
RP 1246-1308
RX MEDLINE; 74055540.
RA Maizels N.M.;
RT "The nucleotide sequence of the lactose messenger ribonucleic acid
RT transcribed from the UV5 promoter mutant of Escherichia coli";
RL Proc. Natl. Acad. Sci. U.S.A. 70:3585-3589(1973).
XX
RN [3]
RX MEDLINE; 74174501.
RA Gilbert W., Maizels N., Maxam A.;
RT "Sequences of controlling regions of the lactose operon";
RL Cold Spring Harb. Symp. Quant. Biol. 38:845-855(1974).
XX
RN [4]
RA Gilbert W., Gralla J., Majors A.J., Maxam A.;
RT "Lactose operator sequences and the action of lac repressor";
RL (in) Sund H., Blauer G. (eds.);
RL PROTEIN-LIGAND INTERACTIONS:193-207;
RL Walter de Gruyter, New York (1975)
XX
RN [5]
RP 1146-1282
[Part of this file has been deleted for brevity]
cgatttggct acatgacatc aaccatatca gcaaaagtga tacgggtatt atttttgccg 4560
ctatttctct gttctcgcta ttattccaac cgctgtttgg tctgctttct gacaaactcg 4620
ggctgcgcaa atacctgctg tggattatta ccggcatgtt agtgatgttt gcgccgttct 4680
ttatttttat cttcgggcca ctgttacaat acaacatttt agtaggatcg attgttggtg 4740
gtatttatct aggcttttgt tttaacgccg gtgcgccagc agtagaggca tttattgaga 4800
aagtcagccg tcgcagtaat ttcgaatttg gtcgcgcgcg gatgtttggc tgtgttggct 4860
gggcgctgtg tgcctcgatt gtcggcatca tgttcaccat caataatcag tttgttttct 4920
ggctgggctc tggctgtgca ctcatcctcg ccgttttact ctttttcgcc aaaacggatg 4980
cgccctcttc tgccacggtt gccaatgcgg taggtgccaa ccattcggca tttagcctta 5040
agctggcact ggaactgttc agacagccaa aactgtggtt tttgtcactg tatgttattg 5100
gcgtttcctg cacctacgat gtttttgacc aacagtttgc taatttcttt acttcgttct 5160
ttgctaccgg tgaacagggt acgcgggtat ttggctacgt aacgacaatg ggcgaattac 5220
ttaacgcctc gattatgttc tttgcgccac tgatcattaa tcgcatcggt gggaaaaacg 5280
ccctgctgct ggctggcact attatgtctg tacgtattat tggctcatcg ttcgccacct 5340
cagcgctgga agtggttatt ctgaaaacgc tgcatatgtt tgaagtaccg ttcctgctgg 5400
tgggctgctt taaatatatt accagccagt ttgaagtgcg tttttcagcg acgatttatc 5460
tggtctgttt ctgcttcttt aagcaactgg cgatgatttt tatgtctgta ctggcgggca 5520
atatgtatga aagcatcggt ttccagggcg cttatctggt gctgggtctg gtggcgctgg 5580
gcttcacctt aatttccgtg ttcacgctta gcggccccgg cccgctttcc ctgctgcgtc 5640
gtcaggtgaa tgaagtcgct taagcaatca atgtcggatg cggcgcgacg cttatccgac 5700
caacatatca taacggagtg atcgcattga acatgccaat gaccgaaaga ataagagcag 5760
gcaagctatt taccgatatg tgcgaaggct taccggaaaa aagacttcgt gggaaaacgt 5820
taatgtatga gtttaatcac tcgcatccat cagaagttga aaaaagagaa agcctgatta 5880
aagaaatgtt tgccacggta ggggaaaacg cctgggtaga accgcctgtc tatttctctt 5940
acggttccaa catccatata ggccgcaatt tttatgcaaa tttcaattta accattgtcg 6000
atgactacac ggtaacaatc ggtgataacg tactgattgc acccaacgtt actctttccg 6060
ttacgggaca ccctgtacac catgaattga gaaaaaacgg cgagatgtac tcttttccga 6120
taacgattgg caataacgtc tggatcggaa gtcatgtggt tattaatcca ggcgtcacca 6180
tcggggataa ttctgttatt ggcgcgggta gtatcgtcac aaaagacatt ccaccaaacg 6240
tcgtggcggc tggcgttcct tgtcgggtta ttcgcgaaat aaacgaccgg gataagcact 6300
attatttcaa agattataaa gttgaatcgt cagtttaaat tataaaaatt gcctgatacg 6360
ctgcgcttat caggcctaca agttcagcga tctacattag ccgcatccgg catgaacaaa 6420
gcgcaggaac aagcgtcgca tcatgcctct ttgacccaca gctgcggaaa acgtactggt 6480
gcaaaacgca gggttatgat catcagccca acgacgcaca gcgcatgaaa tgcccagtcc 6540
atcaggtaat tgccgctgat actacgcagc acgccagaaa accacggggc aagcccggcg 6600
atgataaaac cgattccctg cataaacgcc accagcttgc cagcaatagc cggttgcaca 6660
gagtgatcga gcgccagcag caaacagagc ggaaacgcgc cgcccagacc taacccacac 6720
accatcgccc acaataccgg caattgcatc ggcagccaga taaagccgca gaaccccacc 6780
agttgtaaca ccagcgccag cattaacagt ttgcgccgat cctgatggcg agccatagca 6840
ggcatcagca aagctcctgc ggcttgccca agcgtcatca atgccagtaa ggaaccgctg 6900
tactgcgcgc tggcaccaat ctcaatatag aaagcgggta accaggcaat caggctggcg 6960
taaccgccgt taatcagacc gaagtaaaca cccagcgtcc acgcgcgggg agtgaatacc 7020
acgcgaaccg gagtggttgt tgtcttgtgg gaagaggcga cctcgcgggc gctttgccac 7080
caccaggcaa agagcgcaac aacggcaggc agcgccacca ggcgagtgtt tgataccagg 7140
tttcgctatg ttgaactaac cagggcgtta tggcggcacc aagcccaccg ccgcccatca 7200
gagccgcgga ccacagcccc atcaccagtg gcgtgcgctg ctgaaaccgc cgtttaatca 7260
ccgaagcatc accgcctgaa tgatgccgat ccccacccca ccaagcagtg cgctgctaag 7320
cagcagcgca ctttgcgggt aaagctcacg catcaatgca ccgacggcaa tcagcaacag 7380
actgatggcg acactgcgac gttcgctgac atgctgatga agccagcttc cggccagcgc 7440
cagcccgccc atggtaacca ccggcagagc ggtcgac 7477
//
|
You can specifiy a file of ranges to display in uppercase by giving the '-uppercase' qualifier the value '@' followed by the name of the file containing the ranges. (eg: '-upper @myfile').
The format of the range file is:
An example range file is:
# this is my set of ranges 12 23 4 5 this is like 12-23, but smaller 67 10348 interesting region
You can specifiy a file of ranges to highlight in a different colour when outputting in HTML format (using the '-html' qualifier) by giving the '-highlight' qualifier the value '@' followed by the name of the file containing the ranges. (eg: '-highlight @myfile').
The format of this file is very similar to the format of the above uppercase range file, except that the text after the start and end positions is used as the HTML colour name. This colour name is used 'as is' when specifying the colour in HTML in a '<FONT COLOR=xxx>' construct, (where 'xxx' is the name of the colour).
The standard names of HTML font colours are given in:
http://http://www.w3.org/TR/REC-html40/types.html
and
http://www.ausmall.com.au/freegraf/ncolour2.htm
and
http://mindprod.com/htmlcolours.html
(amongst other places).
An example highlight range file is:
# this is my set of ranges 12 23 red 4 5 darkturquoise 67 10348 #FFE4E1
ECLAC
E.coli lactose operon with lacI, lacZ, lacY and lacA genes.
BssKI
TaqI AciI Ksp632I
\ \ \
gacaccatcgaatggcgcaaaacctttcgcggtatggcatgatagcgcccggaagagagt
10 20 30 40 50 60
----:----|----:----|----:----|----:----|----:----|----:----|
ctgtggtagcttaccgcgttttggaaagcgccataccgtactatcgcgggccttctctca
/ / / /
TaqI AciI | BssKI
Ksp632I
# Enzymes that cut Frequency Isoschizomers
AciI 1
BssKI 1
Ksp632I 1 Bsu6I
TaqI 1
# Enzymes which cut less frequently than the MINCUTS criterion
# Enzymes < MINCUTS Frequency Isoschizomers
# Enzymes which cut more frequently than the MAXCUTS criterion
# Enzymes > MAXCUTS Frequency Isoschizomers
# Enzymes that do not cut
# No. of cutting enzymes which do not match the
# SITELEN, BLUNT, STICKY, COMMERCIAL, AMBIGUOUS citeria
0
|
ECLAC
E.coli lactose operon with lacI, lacZ, lacY and lacA genes.
Hin6I
TaqI | HhaI
| BsiYI | BssKI
| | Hin6I | Ksp632I
| | | HhaI AciI | | HpaII
\ \ \ \ \ \ \ \
gacaccatcgaatggcgcaaaacctttcgcggtatggcatgatagcgcccggaagagagt
10 20 30 40 50 60
----:----|----:----|----:----|----:----|----:----|----:----|
ctgtggtagcttaccgcgttttggaaagcgccataccgtactatcgcgggccttctctca
/ / / / / / / ///
| TaqI | Hin6I AciI | | ||BssKI
BsiYI HhaI | | |HpaII
| | Ksp632I
| Hin6I
HhaI
# Enzymes that cut Frequency Isoschizomers
AciI 1
BsiYI 1 Bsc4I
BssKI 1
HhaI 2
Hin6I 2 HinP1I,HspAI
HpaII 1 BsiSI
Ksp632I 1 Bsu6I
TaqI 1
# Enzymes which cut less frequently than the MINCUTS criterion
# Enzymes < MINCUTS Frequency Isoschizomers
# Enzymes which cut more frequently than the MAXCUTS criterion
# Enzymes > MAXCUTS Frequency Isoschizomers
# Enzymes that do not cut
AclI BamHI BceAI BseYI BsrI ClaI EcoRI EcoRII
HaeIII Hin4I HindII HindIII KpnI MaeII NotI
# No. of cutting enzymes which do not match the
# SITELEN, BLUNT, STICKY, COMMERCIAL, AMBIGUOUS citeria
0
|
ECLAC
E.coli lactose operon with lacI, lacZ, lacY and lacA genes.
Hin6I
TaqI HspAI
| Bsc4I HinP1I
| | HspAI | HhaI
| | Hin6I | BssKI
| | HinP1I | Bsu6I
| | | HhaI AciI | | BsiSI
\ \ \ \ \ \ \ \
gacaccatcgaatggcgcaaaacctttcgcggtatggcatgatagcgcccggaagagagt
10 20 30 40 50 60
----:----|----:----|----:----|----:----|----:----|----:----|
ctgtggtagcttaccgcgttttggaaagcgccataccgtactatcgcgggccttctctca
/ / / / / / / ///
| TaqI | HinP1I AciI | | ||BssKI
Bsc4I | HspAI | | |BsiSI
| Hin6I | | Bsu6I
HhaI | HinP1I
| Hin6I
| HspAI
HhaI
# Enzymes that cut Frequency
AciI 1
Bsc4I 1
BsiSI 1
BssKI 1
Bsu6I 1
HhaI 2
Hin6I 2
HinP1I 2
HspAI 2
TaqI 1
# Enzymes which cut less frequently than the MINCUTS criterion
# Enzymes < MINCUTS Frequency
# Enzymes which cut more frequently than the MAXCUTS criterion
# Enzymes > MAXCUTS Frequency
# Enzymes that do not cut
AclI BamHI BceAI Bse1I BseYI BshI ClaI EcoRI
EcoRII Hin4I HindII HindIII HpyCH4IV KpnI NotI
# No. of cutting enzymes which do not match the
# SITELEN, BLUNT, STICKY, COMMERCIAL, AMBIGUOUS citeria
0
|
ECLAC
E.coli lactose operon with lacI, lacZ, lacY and lacA genes.
Ksp632I
>.........====
HpaII
>===
Hin6I BssKI
>=== >=====
TaqI HhaI Hin6I
>=== ==>= >===
BsiYI AciI HhaI
======>==== >..==== ==>=
gacaccatcgaatggcgcaaaacctttcgcggtatggcatgatagcgcccggaagagagt
10 20 30 40 50 60
----:----|----:----|----:----|----:----|----:----|----:----|
ctgtggtagcttaccgcgttttggaaagcgccataccgtactatcgcgggccttctctca
====<====== <=== =<== <.....====
BsiYI AciI HhaI Ksp632I
===< =<== ===<
TaqI HhaI Hin6I
===< =====<
Hin6I BssKI
===<
HpaII
# Enzymes that cut Frequency Isoschizomers
AciI 1
BsiYI 1 Bsc4I
BssKI 1
HhaI 2
Hin6I 2 HinP1I,HspAI
HpaII 1 BsiSI
Ksp632I 1 Bsu6I
TaqI 1
# Enzymes which cut less frequently than the MINCUTS criterion
# Enzymes < MINCUTS Frequency Isoschizomers
# Enzymes which cut more frequently than the MAXCUTS criterion
# Enzymes > MAXCUTS Frequency Isoschizomers
# Enzymes that do not cut
AclI BamHI BceAI BseYI BsrI ClaI EcoRI EcoRII
HaeIII Hin4I HindII HindIII KpnI MaeII NotI
# No. of cutting enzymes which do not match the
# SITELEN, BLUNT, STICKY, COMMERCIAL, AMBIGUOUS citeria
0
|
The name of the sequence is displayed, followed by the description of the sequence.
The formatted display of cut sites on the sequence follows, with the six-frame translation below it. The cut sites are indicated by a slash character '\' that points to the poition between the nucleotides where the cuts occur. Cuts by many enzymes at the same position are indicated by stacking the enzyme names on top of each other.
At the end the section header 'Enzymes that cut' is displayed followed by a list of the enzymes that cut the specified sequence and the number of times that they cut. For each enzyme that cuts, a list of isoschizomers of that enzyme (sharing the same recognition site pattern and cut sites) is given.
This is followed by lists of the enzymes that do cut, but which cut less often than the '-mincut' qualifier or more often than the '-maxcut' qualifier.
Any of the isoschizomers that are excluded from cutting, (either through restrictions such as the permitted number of cuts, blunt cutters only, single cutters only etc. or because their name has not been given in the input list of enzymes), will not be listed.
Then a list is displayed of the enzymes whose names were input and which match the other criteria ('-sitelen', '-blunt', '-sticky', '-ambiguity' or '-commercial') but which do not cut.
Finally the number of enzymes that were rejected from consideration because they do not match the '-sitelen', '-blunt', '-sticky', '-ambiguity' or '-commercial' criteria is displayed.
The '-flatreformat' qualifier changes the display to emphasise the recognition site of the restriction enzyme, which is indicated by a row of '=' characters. The cut site if pointed to by a '>' or '<' character and if the cut site is not within or imemdiately adjacent to the recognition site, they are linked by a row of '.' characters.
The name of the enzyme is displayed above (or below when the reverse sense site if displayed) the recognition site. The name of the enzyme is also displayed above the cut site if this occurs on a different display line to the recognition site (i.e. if it wraps onto the next line of sequence).
EMBOSS data files are distributed with the application and stored in the standard EMBOSS data directory, which is defined by the EMBOSS environment variable EMBOSS_DATA.
To see the available EMBOSS data files, run:
% embossdata -showall
To fetch one of the data files (for example 'Exxx.dat') into your current directory for you to inspect or modify, run:
% embossdata -fetch -file Exxx.dat
Users can provide their own data files in their own directories. Project specific files can be put in the current directory, or for tidier directory listings in a subdirectory called ".embossdata". Files for all EMBOSS runs can be put in the user's home directory, or again in a subdirectory called ".embossdata".
The directories are searched in the following order:
The EMBOSS REBASE restriction enzyme data files are stored iin directory 'data/REBASE/*' under the EMBOSS installation directory.
These files must first be set up using the program 'rebaseextract'. Running 'rebaseextract' may be the job of your system manager.
The data files are stored in the REBASE directory of the standard EMBOSS data directory. The names are:
The reported enzyme from any one group of isoschizomers (the prototype) is specified in the REBASE database and the information is held in the data file 'embossre.equ'. You may edit this file to set your own preferred prototype, if you wish.
The format of the file "embossre.equ" is
Enzyme-name Prototype-name
i.e. two columns of enzyme names separated by a space. The first name of the pair of enzymes is the name that is not preferred and the second is the preferred (prototype) name.
| Program name | Description |
|---|---|
| abiview | Reads ABI file and display the trace |
| backtranseq | Back translate a protein sequence |
| cirdna | Draws circular maps of DNA constructs |
| coderet | Extract CDS, mRNA and translations from feature tables |
| lindna | Draws linear maps of DNA constructs |
| pepnet | Displays proteins as a helical net |
| pepwheel | Shows protein sequences as helices |
| plotorf | Plot potential open reading frames |
| prettyplot | Displays aligned sequences, with colouring and boxing |
| prettyseq | Output sequence with translated ranges |
| recoder | Remove restriction sites but maintain the same translation |
| redata | Search REBASE for enzyme name, references, suppliers etc |
| restover | Finds restriction enzymes that produce a specific overhang |
| restrict | Finds restriction enzyme cleavage sites |
| seealso | Finds programs sharing group names |
| showalign | Displays a multiple sequence alignment |
| showdb | Displays information on the currently available databases |
| showfeat | Show features of a sequence |
| showorf | Pretty output of DNA translations |
| showseq | Display a sequence with features, translation etc |
| silent | Silent mutation restriction enzyme scan |
| sixpack | Display a DNA sequence with 6-frame translation and ORFs |
| textsearch | Search sequence documentation text. SRS and Entrez are faster! |
| transeq | Translate nucleic acid sequences |
Changed 7 Dec 2000 - GWW - to declare isoschizomers that cut